Volver

CD155 Recombinant Protein

Supplier: Bioworld
Reference: NCP0274
Name: CD155 Recombinant Protein
Category: Protein
Subcategory: Protein
Unit: 500ug/1mg
Price: Consultar
Host: E.coli
Purification: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage conditions: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Note: For research use only, not for use in diagnostic procedure.
Expression system: pet-22b(+)
Aa sequence: TGGCCTCCTCCGGGTACCGGTGATGTTGTGGTTCAGGCACCGACCCAGGTGCCGGGCTTCCTGGGTGATAGTGTTACCCTGCCGTGTTATCTGCAGGTTCCGAATATGGAAGTGACCCATGTTAGTCAGCTGACCTGGGCACGCCATGGTGAAAGCGGTAGCATGGCCGTGTTCCATCAGACCCAGGGTCCGAGTTATAGCGAAAGCAAACGCCTGGAATTCGTGGCAGCCCGCCTGGGTGCAGAACTGCGTAAT
Solicitar hoja técnica Contacto